Camphor modulates TRPV3 cation channels activity by interacting with critical pore-region cysteine residues

Trpv3 ion channels mediate thermo-transduction, nociception, inflammation and dermatitis in mammals. trpv1-4 proteins have been shown to have conserved cysteine-residues in the pore-forming regions. these residues participate in channel activation via s-nitrosylation of channel proteins. camphor is a commonly used ligand for trpv3 channels. thus the knowledge about the potential binding/interacting site(s) for camphor will help to design effective and potent analgesic compounds. in an overlap-extension pcr method, following primer-pairs were used to mutate conserved cysteine-residues in the pore-region of trpv3 channels; gattgagaatcctccaaggacaaaaaggac, trpv3-c612s-fw and gtccttggaggacttctcaatcagtcagtgagg, trpv3-c612s-rv primers pair. and for trpv3-c619s: ggactccagttcctatggccagc, trpv3-c619s-fw and gctggccataggaactggagtcc, trpv3-c619s-rv respectively. all cdna constructs were confirmed by dna-sequencing and used to make crnas. oocytes expressing mtrpv3-c619s and mtrpv3-c612s mutant channels were challenged with 2-apb (1 mm), camphor (10 mm) and dihydrocarveol (10 mm) either at –40 mv or +40 mv holding potentials in voltage-clamp experiments. responses of both mutants to 2-apb were similar to wild-type mtrpv3. interestingly, responses to camphor were totally lost in mtrpv3-c619s mutant, while responses to dihydrocarveol remained intact. in contrast mtrpv3-c612s displayed slightly altered (16±2 % reduction) phenotype with respect to camphor sensitivity. it is concluded that pore-region cysteines play critical role in camphor sensitivity of trpv3 ion channels.