|
|
|
|
مقایسه علایم، تعیین توالی کامل و تحلیل فیلوژنتیکی جدایههای ویروس تریستزای مرکبات از استانهای مازندران و فارس
|
|
|
|
|
|
|
|
نویسنده
|
روحانی ندا ,زکی عقل محمد ,مهرور محسن
|
|
منبع
|
پژوهش هاي حفاظت گياهان ايران - 1402 - دوره : 37 - شماره : 3 - صفحه:237 -258
|
|
چکیده
|
ویروس تریستزای مرکبات (citrus tristeza virus-ctv) یکی از بیماری های مهم درختان مرکبات در اغلب مرکبات کاریهای ایران است. در این تحقیق توالی کامل ویروس تریستزای مرکبات از دو منطقه مرکبات خیز استان مازندران و استان فارس تعیین و برخی صفات بیولوژیکی و مولکولی آن ها با یکدیگر مقایسه شده است. 56 درصد از نمونه های جمعآوری شده از استان مازندران و 32 درصد نمونههای تهیه شده از استان فارس در آزمون زنجیره ای پلی مراز آلوده به ویروس تریستزای مرکبات بودند. علایم ctv در نمونههای مرکبات استان مازندران کوتولگی خفیف تا شدید، سرخشکیدگی، زردی، زردی رگبرگ و زوال سریع بود در حالی که در نمونههای استان فارس علایم ctv، کوتولگی، سبزخشکیدگی، زردی، و سرخشکیدگی شاخهها بود. سه ماه پس از مایه زنی نیز علائم کوتولگی شدید، رگبرگ روشنی، زردی و ریزبرگی در نهالهای مایهزنی شده با جدایههای استان مازندران و علایم کوتولگی خفیف، رگبرگ روشنی، زردی و ریزبرگی در نهال های نارنج بذری مایهزنی شده با جدایههای استان فارس ایجاد شد. از درختان مرکبات آلوده به تریستزا از استانهای فارس و مازندران نمونه برداری و از آنها کتابخانه srna تهیه و توالی یابی شدند. نتایج نشان داد که طول ژنوم کامل بازسازی شده برای جدایه های ir-north1، ir-north2، ir-south1 و ir-south2 بهترتیب 19296، 19302، 19252 و 19251 نوکلئوتید است و در سطح نوکلئوتیدی با سایر جدایه های ctv موجود در بانک ژن بین 77.5-95.2 درصد شباهت داشتند. بررسی توالی پروتئین ها نشاندهنده وجود 280 جایگزینی در 33 موتیف در جدایههای توالی یابی شده ctv بود. کمترین تغییرات در جدایه ir-north1 با پنج جایگزینی بود. در جدایه های ir-north2، ir-south1 و ir-south2 بهترتیب 97، 85 و 93 جایگزینی اتفاق افتاده بود. بیشترین جایگزینی در چارچوبهای ژنی orf1a و p61 بود. تعیین سویه جدایه ها با همانندسازی و هضم مجازی و همردیفسازی ناحیه بین ژن های پوشش پروتئینی کوچک (cpm) و پوشش پروتئینی نشان داد که جدایه ir-north1 مشابه نژادهای مولد زوال سریع و سویه t36 و جدایه های ir-south2، ir-north2 و ir-south1 از نژادهای مولد ساقه آبلهای و زردی نهالچه و بهترتیب مشابه با سویه t3، sy و t318a هستند. در درخت فیلوژنی ترسیم شده بر اساس طول کامل ژنوم نیز سه جدایه ir-north2 و ir-south1 و ir-south2، در گروه vt و جدایه ir-north 1 در گروه t36 قرار گرفتند. همچنین بررسی وقوع نوترکیبی احتمالی در جدایههای ایرانی نشان داد که جدایههای ir-north1، ir-north2 و ir-south1 در ژن های رپلیکاز و p65 نوترکیب هستند. نتایج بررسی علائم و توالی کامل چهار جدایه بدست آمده نشان داد که دو جدایه بدست آمده از استان مازندران از لحاظ نوع علائم و جایگاه فیلوژنی از هم متفاوت هستند ولی دو جدایه استان فارس از نظر فیلوژنی و ژنوتیپی با یکدیگر قرابت دارند.
|
|
کلیدواژه
|
توالییابی نسل جدید، زردی نهالچه، زوال سریع، ساقهآبلهای، مرکبات، نژاد
|
|
آدرس
|
دانشگاه فردوسی مشهد, دانشکده کشاورزی, گروه گیاه پزشکی, ایران, دانشگاه فردوسی مشهد, دانشکده کشاورزی, گروه گیاهپزشکی, ایران, دانشگاه فردوسی مشهد, دانشکده کشاورزی, گروه گیاهپزشکی, ایران
|
|
پست الکترونیکی
|
mehrvar@um.ac.ir
|
|
|
|
|
|
|
|
|
|
|
|
|
comparison of symptoms, whole genome sequencing, and phylogenetic analysis of isolates of citrus tristeza virus from mazandaran and fars provinces in iran
|
|
|
|
|
Authors
|
rouhani n. ,zakiaghl m. ,mehrvar m.
|
|
Abstract
|
introductioncitrus tristeza virus (ctv) is one of the most devastating citrus diseases in iran. the ctv genome is a positive single-stranded rna molecule with a size of 19.3 kb containing 12 open reading frames (orfs). ctv encodes two different coat proteins, of which the small coat protein (cpm) covers only the 3’ end of the genome. ctv infected trees show symptoms such as stunting, yellows, reduced vigor and death. in addition, ctv generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. in total, more than 259 thousand hectares of citrus are grown in the north and south of iran. considering the lack of the complete genome sequence of iranian ctv isolates and the different climatic conditions in citrus cultivation in the north and south of iran, the genome of ctv isolates from iran was determined for the first time and their phylogenetic relationships with other ctv isolates were studied. materials and methodsin spring and fall 2015, 30 samples from mazandaran province in northern iran and 25 samples from fars province in southern iran were collected from trees suspected of being infected with ctvs. total rna was extracted using the rnx-plus kit according to the manufacturer’s instructions. ctv was identified using the specific primer pair cpf (5¢aaagaaggcgacgatgttgt3¢) and cpr (5¢agctccggtccaagaaatctg3¢) designed based on the coat protein gene of ctv. reverse transcription was performed using mmulv reverse transcriptase (pars tuos, iran) and pcr reaction was performed using amplicon 2x pcr master mix (amplicon, denmark). infected samples were grafted onto sour orange seedlings. srnas were extracted using a protocol developed by carra et al. (2006), and srna libraries were prepared according to the cats protocol (turchinovich et al., 2014). one microgram of each library was sequenced on the illumina hiseq2500 platform from macrogen, south korea. the ctv strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (cpm) and coat protein (cp) genes. the phylogenetic tree was constructed by the maximum likelihood method using the t92+i nucleotide substitution model with 500 bootstrap repeats by mega7. the nucleotide and amino acid similarity matrix was calculated using sdtv.1.2 software. potential recombination events in the genome were determined using rdp v.5.5. results and discussionctv infection was detected in 17 samples from mazandaran province (56% of samples) and in 8 samples from fars province (33% of samples) using a cpf/r-specific primer pair. ctv symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of iran, while ctv symptoms in the samples from the south of iran were stunting, chlorosis, dieback and quick decline. three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with ctv isolates from the south. by assembling the contigs obtained from the rna-seq data, the complete genomes of ir-north1, ir-north2, ir-south1, and ir-south2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. the iranian ctv isolates had nucleotide similarity in the range of 95.2-77.5% with other ctv isolates deposited in genbank.
|
|
Keywords
|
citrus ,quick decline ,ngs ,race ,seedling yellows ,stem pitting
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|