پراکنش و تحلیل تبارزایی ویروس برگ بادبزنی مو در باغات انگور استان خراسان رضوی بر‌اساس پروتئین پوششی

ویروس برگ باد بزنی مو (grapevine fanleaf virus, gflv) در تاکستان‌های مناطق مختلف دنیا شیوع دارد. علائم ایجاد شده توسط این ویروس اغلب در سه گروه برگ بادبزنی، موزاییک زرد و رگبرگ نواری تقسیم‌بندی شده‌اند که علت تفاوت در ایجاد علائم، به تنوع ژنتیکی جدایه‌ها نسبت داده شده است. شدت علائم ایجاد شده به جدایه‌ی ویروس، حساسیت رقم مو و شرایط محیطی بستگی دارد. در این تحقیق پراکنش و تحلیل تبارزایی ناحیه کدکننده پروتئین پوششی ویروس بررسی شد. نمونه‌ها از تاکستان‌های‌ استان خراسان رضوی جمع‌آوری و ژن پروتئین پوششی از پنج جدایه تکثیر، همسانه‌سازی و تعیین ترادف گردید. به این منظور، تعداد 109 نمونه برگ دارای علائم‌ از تاکستان‌ها جمع‌آوری و در آزمون الایزا با استفاده از آنتی‌بادی اختصاصی gflv آلودگی به ویروس در 58 نمونه تایید شد. بیشترین میزان آلودگی در بین نمونه‌های جمع‌آوری شده از منطقه محمدیه واقع در شهرستان کاشمر بود. با استفاده از آغازگرهای اختصاصی قطعه‌ای بطول 1760 جفت باز مربوط به طول کامل ناحیه کد‌کننده پروتئین پوششی ویروس و قسمتی از انتهای’3 ژنوم تکثیر شد. پروتئین پوششی جدایه‌های انتخاب شده در سطح نوکلئوتیدی و آمینواسیدی به‌ترتیب 9490 و 9791 درصد با جدایه‌های سایر نقاط دنیا شباهت داشت. تحلیل تبارزائی بر اساس ناحیه کد کننده پروتئین پوششی، جدایه‌های ایرانی gflv را در شاخه‌ای مجزا از جدایه‌های سایر نقاط دنیا قرار داد. همچنین جدایه‌های شمال شرق کشور در گروهی مجزا از جدایه‌های شمال غرب کشور قرار گرفتند، که نشان‌دهنده اثر جدایی جغرافیایی در تکامل gflv است. نتایج حاصل از این تحقیق بیانگر بومی بودن gflv در ایران و گسترش احتمالی آن از این منطقه به سایر نقاط جهان است.

Distribution and Phylogeny of Grapevine fanleaf virus in Vineyards of Khorasan Razavi Province Based on Coat Protein Region

Introduction: Virus and viruslike diseases cause intensive damage in vineyards all over the world. Grapevine fanleaf virus (GFLV) is one of the most economic important viruses infecting grapevine worldwide. It is a major limiting factor for grapevine productions and reduces fruit quality and shortens the longevity of grapevines in the vineyards. GFLV belongs to the genus Nepovirus in the family Secoviridae and has a bipartite singlestranded positive RNA genome which encapsidated in isometric particles. Both RNA molecules contain a genomelinked viral protein (VPg) at 5’ end and a poly (A) tail at 3’ end of genome. GFLV is transmitted naturally from grapevine to grapevine by the ectoparasitic nematode Xiphinema index in the vineyard. Fanleaf disease causes three groups of symptoms, including malformation, vein clearing and yellowing. This difference in symptoms is related to diversity in the genome of the virus because in one cultivar can be seen both groups of symptoms. Khorasan Razavi province has the third largest area under grape cultivation in Iran in this study we studied distribution and diversity of GFLV isolates in vineyards of Khorasan Razavi province.Materials and MethodsPlant material and virus isolatesDuring two consecutive growing seasons of 2019 and 2020, a survey was conducted in some of the major areas under the cultivation of grapevine in Khorasan Razavi (Kashmar, Khalilabad, Mohammadiyeh Bardaskan, Neyshabour) at the northeast of Iran. A total of 109 grapevines samples were collected and tested for GFLV infection by enzymelinked immunosorbent assay (ELISA) as described by Clark and Adams (1977). Total RNA was extracted from petioles of ELISA positive samples using CTABPVPP method and were used directly or stored at 70 0C.Reverse transcriptase –PCR, cloning and sequencingcDNA was synthesized by Thermoresistant MMuLV reverse transcriptase (Parstous, Iran) according to the manufacturer’s protocol. RTPCR using specific primer pairs MpF (5’ AGAAGTCGCTCACGATCTGTGAGG 3’) and CpR (5’ ACAAACAACACACTGTCGCC 3’) was amplified 1760 bp fragment corresponding to the complete length of coat protein and 230 nucleotides of 3’ proximal end in order to detect infected samples. The RTPCR products were electrophoresed on 1% agarose gel, stained with Green viewer (Pars tous, IRAN), and visualized by UV light.The gel extracted PCR products were cloned into, pTG19T PCR Cloning Vector, (Vivantis, Malaysia) following the manufacturer’s instructions and were transformed to Escherichia coli strain DH5α. Then colonyPCR using M13 and the specific primer pairs were used to confirm the recombinant clones. Random recombinant clones were selected to extract plasmid DNA using a Qiagen Plasmid Miniprep Kit (Qiagen, Germany). Finally, The GFLV coat protein gene has been sequenced in both directions.Results and Discussion: In this study, 109 samples of symptomatic vines were collected from the vineyards of Khorasan Razavi province. 58 samples were confirmed to be infected using indirect ELISA and reverse transcriptase polymerase chain reaction tests. The most symptoms in vineyards were vein banding, leaf malformation, open petiolar sinus, stunting and bushy growth of shoot, zigzagged shoot and double nodes in infected stem. The prevalence of this virus was high in the samples of Mohammadiyeh region. cDAN fragment of GFLV genome with 1760 bp in length corresponding to the GFLV coat protein gene was amplified with specific primers. Fulllength sequences of the coat protein gene were recorded in the GenBank. Nucleotide sequence identities of 9094% were found between the coat protein region of isolates of this study and that of deposited in the GenBank previously. Phylogenetic analysis carried out on the GFLVCP gene of 5 Iranian GFLV sequences selected in this study showed that GFLV isolates of Iran and the world in the phylogenetic tree were divided into two main groups.Conclusion: The virus has been detected in northwestern, northeastern and southern vineyards in Iran. Probably GFLV originated in Iran, so widespread spread of the virus in these areas is possible. The propagation of infected cuttings has played a major role in the spread of the virus in vineyards. The capsid protein gene is a conserved region and be used in the molecular phylogenetic analysis and it is the sole viral determinant of the specific transmission of GFLV by its vector. Phylogenetic analysis carried out on the GFLVCP showed that GFLV isolates were separated into two statistically significant clusters: the first one (I) including isolates from Iran, and the second one (II) including isolates from different countries, and Iranian isolates of GFLV have distinct position in phylogentic tree. Furthermore, evidence of divergent evolution was observed between isolates from northwest, northeast and south of Iran. It confirms that genetic makeup of GFLV may be affected by geographical isolation. The percentage of GFLV infected samples in summer was much lower than the samples detected in midspring. The results of previous research also indicated that GFLV titer in the grapevines drops during the summer hot season. High genetic diversity has been observed in coat proteins gene, this change may be due to an error in the RNAdependent RNA polymerase (RdRp) enzyme during amplification or due to recombination events. Geographical area among them has a positive effect on evolution and phylogenetic relationships.