|
|
a case report of heavy hydatidosis in a chimpanzee referred from a zoo in shiraz city, iran
|
|
|
|
|
نویسنده
|
mohseni atousa ,mousivand asma ,rakhshandehroo ehsan ,mootabi alavi amir
|
منبع
|
دومين كنگره ملي عفونت و ايمني - 1403 - دوره : 2 - دومین کنگره ملی عفونت و ایمنی - کد همایش: 03240-72134 - صفحه:0 -0
|
چکیده
|
Hydatid disease (echinococcosis) represent a significant parasitic disease affecting various animal species worldwide. the disease has garnered attention not only for its impact on animal health but also for the potential of zoonotic implications. this case report shows a fatal case involving the rupture of a pulmonary hydatid cyst in a chimpanzee, shedding light on the diagnosis of echinococcus infection in non-human primates. a dead adult male chimpanzee was referred from a local zoo to the clinic of the school of veterinary medicine, shiraz university. in order to detect the parasite identity, samples from the spleen and liver cysts were separated and used to perform dna extraction. these samples were then subjected to molecular identification by pcr targeting the cytochrome c oxidase subunit i (cox1) gene. primers, f (ttttttgggcatcctgaggtttat) and r (taaagaaagaacataaatgaaaatg) were used and the products were sequenced. the hydatid cysts were significantly found in the lung, liver, spleen and also the pericardium. a total of 22 cysts were isolated. in molecular assay, the samples were successfully amplified and bands with expected size of about 450 bp were obtained. the sequence data obtained in the present work were accordant (with more than 98% identity) with those previously reported for echinococcus granulosus strain g1. according to the literature, hydatid cyst in primates has not been investigated in iran and other parts of the world. in this work, the g1 strain is often recovered from ruminants particularly from sheep. this result revealed that the presented animal has entered to the dog-sheep cycle of the worm. it specifically emphasizes to perform control strategies in zoo parks to prevent contamination of food and water sources with echinococcus eggs expelled from dogs live in surrounding environment.
|
کلیدواژه
|
hydatid cyst ,chimpanzee ,echinococcus granulosus
|
آدرس
|
, iran, , iran, , iran, , iran
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Authors
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|