|
|
|
|
genetic diversity of candidatus phytoplasma aurantifolia using single-strand conformational polymorphism analysis and sequence analyses of the groupii intron gene
|
|
|
|
|
DOR
|
20.1001.2.9920068682.1399.1.1.354.8
|
|
نویسنده
|
golmohammadi morteza ,nourizadeh sina ,khakvar reza
|
|
منبع
|
ژنتيك ايران - 1399 - دوره : 16 - شانزدهمین کنگره و چهارمین کنگره بین المللی ژنتیک ایران - کد همایش: 99200-68682
|
|
چکیده
|
Background and aim: forty-one citrus trees infected by ‘candidatus phytoplasma aurantifolia’ were examined using single-strand conformation polymorphism (sscp) and sequence analysis of a variable groupii intron gene fragment. scp analysis of polymerase chain reaction-amplified groupii intron gene fragments revealed diverse profiles, differing in number and position of the bands. pcr fragments were sequenced to corroborate sscp results. the phylogenetic tree derived from the nucleic acid sequences revealed three different sequevar and agreed with the sscp typing. the polymorphism of the groupii intron fragment predestine this gene as a molecular marker for tracking strains in epidemiological studiesmethods: plant material leaf midribs from 41 phytoplasma-infected (candidatus phytoplasma aurantifolia) citrus plants grown in commercial orchards or private gardens in hormozgan and kerman provinces, were sampled and lyophilized. table 1 candidatus phytoplasma aurantifolia phytoplasmas isolates used in this study isolate code host plant genus/species common name region elevation genbank accession numbersji1 citrus aurantifolia traction and polymerase chain reaction the total genomic dna extraction was performed following the protocol described by murray and thompson (1980). the dna extracted were subjected to pcr with phytoplasma universal primer pairs p1a and p7a (lee et al., 2004) to amplify a major portion of ribosomal dna. the following primers (siampour et al., 2015) were used were used to amplify a ~900-bp fragment of retroelement gene homologues from all phytoplasma strains: intf1 (5’-ataacacgttgaagaatcgct -3’) / intr1 (5’- tatacgagttttattgtggattc -3’). amplifications of phytoplasma ribosomal dna and retroelements were performed with pcr conditions as described (lee et al., 2004, siampour et al., 2015) single-strand conformation polymorphism (sscp) and gel analysis the sscp analysis of pcr product from retroelement gene was carried out following the protocol described in more details elsewhere (music´ & škoric´, 2013). samples were separated on 8% acrylamide-bisacrylamide non denaturing gels and electrophoresed in 1× tbe buffer at 200 v for 4 h at 4℃. the sscp profiles were visualized by ethidium bromide staining (yap & mcgee, 1992). sequence analysis phytoplasma identification was performed by sequence analysis of ribosomal dna (16srdna) amplicons using the primers p1a/p7a. nucleotide sequence data of 16srdna and retroelement gene were submitted to the genbank (table 1). the sequence data of retroelement gene fragment has been submitted to the genebank database with accession numbers mh622870 (fa1), mh622903 (zr1), mh622877 (ha6), mh622879 (jd2), mh622885 (me1), mh622883 (kah2), mh622867 (de5) and mh622889 (min1).results: a total of 41 field sites were analyzed in this study, 26 from the hormozgan province and 15 field from kerman province. the p1a/p7a amplicons were sequenced and species identified by comparison with 16s rdna sequences of reference phytoplasmas in genbank/embl databases. the analysis confirmed that citrus trees were infected by ‘ca. p. aurantifolia’ (table 1). sscp analysis was performed on all amplified phytoplasma retroelement fragments. the sscp analysis of the citrus samples yielded three different banding patterns. this analysis showed that each infected sample carries mainly one sequence sequevar of pat. examples of the various profile fig. 1 three different sscp banding patterns obtained from analysis of 900 bp pcr products from the retroelement genes of 41 pat are depicted in fig. 1. the single stranded dna molecules typically formed 2 to 3 bands after denaturation in formamide buffer. the pcr products from the selected representative samples showing different sscp profiles were sequenced on both strands using the same primers employed for their amplification with direct sanger sequencing by microsynth, switzerland. sequencing of retroelement area (groupii intron reverse transcriptase/mature) allowed the assembly of 889 nucleotides fragment, including the partial n-terminal reverse transcriptase (rt) domain. multiple alignments of chosen sequenced fragments showed that the ones having the same sscp profiles also showed sequence variation and three sequevars (seq) including: seq1 (fa1, zr1, ha6, jd2, me1 and min1), seq2 (de5) and seq3 (kah2) were detected among phytoplasmas infecting citrus host. the nucleic acid homology amongst the ‘ca. p. aurantifolia strain. ranged between 96.1-100%. in a multiple alignment of the protein sequences (fig. 2) substitutions occurred in less than 4 positions (fig. 2) in sequevar3 (kah2). phylogenetic analyses (fig. 3) of phytoplasma sequences obtained in this study corroborated the sscp results. phylogeny based on groupii intron reverse transcriptase/matures distinguished four separate clusters supported by high bootstrap value and revealing much higher diversity among iranian strains. the nucleotide sequences of fragments having similar sscp profiles clustered together on the phylogenetic tree, indicating their close relatedness. fig. 2 sequence alignment and characteristics of group ii intron reverse transcriptase/maturase proteins c. p. aurantifolia. deduced amino acid sequence highlited in gray and are underlined fig. 3 phylogenetic trees for the representative phytoplasma retroelement (groupii intron reverse transcriptase/maturase) sequences. the trees were constructed by the upgma method with the tamura 3-parameter method by using the mega v7 program package. bootstrap values are given above the branches. trees for the were rooted by using corresponding peanut withes’ broom, vaccinium withes’ broom phytoplasma and bacillus cereus sequences as an outgroup.conclusion: the sscp analysis results of the phytoplasma retroelement genes revealed the presence of molecular variability among iranian c. p. aurantifolia strains. based on the present study, molecular markers present in the 16s-23s rdna locus showed (data not shown)close genetic relationship between citrus phytoplasma strains which is in agreement with previous study indicated the existence of a limited variation among ‘ca. p. aurantifolia’ strains based on the 16s rrna gene. (al-ghaithi et al., 2018). presence of snps in groupii intron reverse transcriptase/mature genes allowed grouping of the ‘ca. p. aurantifolia’ into three sequevar, indicated that the groupii intron reverse transcriptase genes will greatly benefit as a molecular marker to identify strains and track their spread in the field. on other hand sscp the technique provides an inexpensive, convenient, and sensitive method for determining sequence variation and to differentiate phytoplasma strains when dealing with a large number of field samples. thus, sscp analysis can also be considered as a successful fingerprinting tool in the analysis of phytoplasma genes.
|
|
کلیدواژه
|
lime ,candidatus phytoplasma aurantifolia ,diversity ,sscp
|
|
آدرس
|
agricultural research education and extension organization (areeo), iran, tabriz university, iran, tabriz university, iran
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Authors
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|