>
Fa   |   Ar   |   En
   امکان سنجی تعیین جنسیت جنین مرغ بومی ایران با استفاده از طیف سنجی رامان  
   
نویسنده رستمی سپیده ,بیگی نصیری محمدتقی ,نظری محمود ,چراغی زاده محسن
منبع تحقيقات توليدات دامي - 1403 - دوره : 13 - شماره : 3 - صفحه:19 -31
چکیده    مطالعه حاضر به منظور بررسی امکان سنجی تعیین جنسیت جنین مرغ بومی ایران با استفاده از طیف سنجی رامان انجام شد. تعیین جنسیت جنین ها با استفاده از طیف سنجی رامان با طول موج  nm785 در روز 3.5 انکوباسیون انجام گرفت. صحت سنجی این روش با استفاده از روش واکنش زنجیره ای پلیمراز مورد بررسی قرار گرفت. طیف‌های به‌دست‌آمده از طیف سنج رامان با استفاده از نرم افزار origin رسم شده و مورد تجزیه و تحلیل قرار گرفتند. شاخص های اصلی مورد استفاده جهت تجزیه و تحلیل طیف رامان، شدت اوج های رامانی و نسبت شدت اوج های غالب بودند. در واکنش زنجیره ای پلیمراز، یک قطعه به طول 461 جفت باز برای جنین های با جنسیت نر (zz) و دو قطعه با طول های 461 و 322 جفت باز برای جنین هایی با جنسیت ماده (zw) تکثیر شد. نتایج طیف سنجی نشان داد شدت باندهای رامانی در جنسیت های مختلف متفاوت است، به طوری که شدت باندهای رامانی در جنس نر، بیشتر و در جنس ماده، کمتر بود. بنابراین، تغییرات شدت طیف های رامان را می توان ملاک تشخیص جنسیت قرار داد. همچنین، نتایج حاصل از رسم نمودار شمعی داده ها به صورت تجمعی نشان داد که مقادیر میانه و میانگین در هر دو نسبت برای جنسیت نر دارای مقدار بزرگتری در مقایسه با جنسیت ماده بود. با توجه به نتایج به دست آمده، این گونه استنباط می شود که طیف سنجی رامان می تواند به عنوان روشی مناسب جهت تعیین جنسیت جنین مرغ طی مراحل جوجه کشی مورد استفاده قرار گیرد و به دلیل کوتاه بودن زمان انجام آزمایش می تواند بهترین شرایط را برای استقرار در صنعت فراهم کرده و جنسیت را با دقت بالا مشخص نماید.
کلیدواژه تعیین جنسیت، جنین مرغ، طیف سنجی رامان، واکنش زنجیره ای پلیمراز
آدرس دانشگاه علوم کشاورزی و منابع طبیعی خوزستان, دانشکده علوم دامی و صنایع غذایی, گروه علوم دامی, ایران, دانشگاه علوم کشاورزی و منابع طبیعی خوزستان, دانشکده علوم دامی و صنایع غذایی, گروه علوم دامی, ایران, دانشگاه علوم کشاورزی و منابع طبیعی خوزستان, دانشکده علوم دامی و صنایع غذایی, گروه علوم دامی, ایران, دانشگاه آزاد اسلامی واحد اهواز, مرکز تحقیقات مهندسی سطح پیشرفته و نانو مواد, گروه مهندسی برق, ایران
پست الکترونیکی mcheraghizade@gmail.com
 
   feasibility of embryo sex determination for iranian native chicks using raman spectroscopy  
   
Authors rostami s. ,beigi nassiri m. t. ,nazari m. ,cheraghizadeh m.
Abstract    introduction: the sex of chickens considerably impacts production performance and economic benefits in poultry farming. male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. day-old male chicks in the laying hen industry are usually culled immediately after hatching. as a result, this issue has caused moral concerns in societies. efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. in large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines’ vent, color, or feathers. however, these methods are still time- and labor-consuming. if sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, co2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. in recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (raman spectroscopy, fluorescent, 3d x-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (voc)-based techniques. commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. an alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. recently, raman spectroscopy was reported to determine the sex of eggs at the incubation stage. raman spectroscopy is based on the raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. the reflected light’s wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. thus, raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. therefore, resonance raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. for this purpose, the present study was carried out to investigate the feasibility of determining the sex of iranian native chicken embryos using the raman spectroscopy.materials and methods: to carry out this research, 100 fertilized eggs of iranian native chickens were used. the sex of the embryos was determined using raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. validation of this method was investigated using the polymerase chain reaction (pcr) technique. sequence alignment of chd-z and chd-w allele sequences amplified by pcr technique. the amplified dna fragments were single and double dna bands in the size of 461 bp for the chd-z and 322 bp for the chd-w genes. the pcr was carried out using a pcr master kit with specific primers (the forward primer: 5′- tatcgtcagtttccttttcaggt -3′, the reverse primer: 5′- ccttttattgatccatcaagcct -3′). thermal cycling conditions for dna amplification were: 1 cycle of initial denaturation at 94°c for 5 minutes; 35 cycles comprising 30s at 94°c for the denaturation, 30s at 59°c for annealing, 30s at 72°c for the elongation; and a final extension cycle at 72°c for 5 minutes. the pcr products were analyzed by electrophoresis on 2.5% agarose gel against a dna ladder 100bp, and visualized using the safe staining on uv transilluminator. the data obtained from the raman spectrometer was analyzed using the origin software. the main indices used to study the data were the intensity of the raman peaks and the ratio of the dominant peak intensity. additionally, principal component analysis (pca) was employed to identify any patterns in the data. to calculate pca1 and pc2, the ratios of i769/i838 and i1141/i1251 peaks were considered, respectively. pca analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes.results and discussion: the result of pcr showed that one fragment with a length of 461 bp was amplified for male embryos (zz) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (zw(. the study found that there are differences in the intensity of raman bands between genders. males have higher intensity while females have lower intensity. therefore, changes in raman spectra intensity can be used to identify gender. additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. furthermore, the results obtained from pca analysis showed that the variance percentages for pc1 and pc2 were 53.69% and 46.31%, respectively. pc2 is more reliable as it has less deviation.conclusions: based on the results obtained from the study, it can be concluded that raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. this test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. in general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.
Keywords sex determination ,chicken embryo ,raman spectroscopy ,polymerase chain reaction
 
 

Copyright 2023
Islamic World Science Citation Center
All Rights Reserved