>
Fa   |   Ar   |   En
   ارتباط چندشکلی اگزون 1 ژن thrsp با صفات وزن بدن و تعداد فرزند در هر زایش در بزهای مرخز  
   
نویسنده قاسمی مریم ,زمانی پویا ,عبدلی رامین ,مرادعلیان علی
منبع تحقيقات توليدات دامي - 1401 - دوره : 11 - شماره : 2 - صفحه:81 -92
چکیده    ژن پروتئین واکنشی هورمون تیروئید (thrsp) یکی از ژن های کاندید در فرآیندهای لیپوژنز و مرتبط با صفات تولیدی در جانوران است. پژوهش حاضر با هدف بررسی چندشکلی اگزون 1 ژن thrsp و ارتباط آن با صفات وزن بدن و تعداد فرزند در هر زایش در بزهای مرخز انجام شد. از تعداد 140 بز مرخز به‌طور تصادفی نمونه های خون تهیه و dna آن‌ها استخراج شد. برای تکثیر یک قطعه 486 جفت بازی از اگزون 1 ژن thrsp، یک جفت آغازگر طراحی و واکنش زنجیره ای پلیمراز انجام شد. چندشکلی بخش تکثیر شده، با روش‌های چندشکلی فضایی تک رشته ای (sscp) و توالی یابی dna مورد بررسی قرار گرفت. در نمونه های مورد مطالعه، دو الگوی باندی متفاوت sscp و دو چندشکلی تک نوکلئوتیدی به صورت g.148g>a (منجر به تغییر اسید آمینه آرژنین به گلوتامین) و g.173a>g (جهش هم معنی)، هر دو به‌صورت جایگاه‌های هتروزیگوت شناسایی شدند. اثر چندشکلی این ژن روی صفات وزن بدن معنی دار نبود، اما تعداد فرزند در هر زایش به‌طور معنی‌داری در افراد دارای ژنوتیپ هتروزیگوت مضاعف به میزان 0.17 بالاتر از افراد دارای ژنوتیپ هموزیگوت مضاعف بود (0.05p <). بر اساس نتایج می توان ژن thrsp را به عنوان یک ژن کاندید برای صفت تعداد فرزند در هر زایش در نظر گرفت و از چندشکلی های تک نوکلئوتیدی شناسایی شده در انتخاب به کمک نشانگر بهره گرفت.
کلیدواژه انتخاب به کمک نشانگر، باروری، تولیدمثل، چندشکلی تک نوکلوتیدی، ژن کاندید
آدرس دانشگاه بوعلی سینا, دانشکده کشاورزی, گروه علوم دامی, ایران, دانشگاه بوعلی سینا, دانشکده کشاورزی, گروه علوم دامی, ایران, سازمان تحقیقات، آموزش و ترویج کشاورزی, مرکز تحقیقات ابریشم کشور, ایران, دانشگاه بوعلی سینا, دانشکده کشاورزی, گروه علوم دامی, ایران
پست الکترونیکی ali.moradalian@yahoo.com
 
   association of the thrsp gene exon 1 polymorphism with body weight traits and litter size in markhoz goats  
   
Authors ghasemi m. ,zamani p. ,abdoli r. ,moradalian a.
Abstract    introduction: generally, genetic markers, associated with metabolic pathways, might be used in markerassisted selection to improve production and reproduction traits in farm animals. especially, some traits with low heritabilities, such as reproduction and health traits could not be easily improved by classic selection strategies. however, the use of genetic markers and markerassisted selection are considered powerful tools for the genetic improvement of lowheritable traits. thus, detection of genetic markers associated with production and reproduction traits is an effective way to save endangered indigenous breeds, such as the markhoz goat, a mohairproducing breed in iran. the thyroid hormoneresponsive (thrsp) gene is a candidate gene involved in thyroid hormone functions and the lipogenesis process. this gene is a proteincoding gene, with two exons, located on chromosome 29 in goats. there are some reports on the association of thrsp with production traits in farm animals. there are limited studies on metabolic pathways of thrsp and its associations with important economic traits in small ruminants and no study on the association of thrsp and reproduction traits was found in the literature. the aim of the present study was the investigation of the thrsp gene polymorphism and its association with body weight and litter size traits in markhoz goats.materials and methods: a total of 140 blood samples of markhoz goats were randomly collected from the research and breeding station in kurdistan province in western iran. genomic dna was extracted from whole blood samples. a pair of primers were designed using the primer 3 online software to amplify a 486 bp fragment in thrsp gene exon 1. the designed primers were as follows:forward: 5’agtctgcgggactccatatg3’reverse: 5’aaaatgggacaggccatgt3’polymorphism of the amplified fragment was investigated using the singlestrand conformational polymorphism (sscp) method and sequencing of three random samples for each sscp pattern. the observed sequences were aligned to the genbank reference sequence using the megalign module of dnastar software and compared based on the clustal w method. the sequences were translated by the translate section of the expasy website (us.expasy.org/translatetool). associations of body weight traits, including birth weight, threemonth, sixmonth, ninemonth, and 12month body weights, with the observed genotypes were investigated using a general linear model, fitting genotype, birth year, birth type, and dam age as the fixed factors. the association of the observed genotypes with litter size was investigated using a twoway chisquared test. the sas 9.4 program was employed for the association analyses.results and discussion: in the studied samples, two different sscp patterns and two singlenucleotide polymorphisms (snps) were detected in 148 and 173 bp locations of the studied fragment, as g.148g>a (resulting in arginine to glutamine amino acids exchange) and g.173a>g (a synonymous mutation), both as heterozygous loci. in the studied population, the frequency of the doublehomozygous genotype, gg/aa (0.743), was noticeably higher than the doubleheterozygous genotype, which is ga/ag (0.257). the alleles g and a had high frequencies, both equal to 0.871 in the 148 and 173 bp loci, respectively. both loci had a significant deviation from hardyweinburg equilibrium (p<0.0001). polymorphism of the studied fragment did not have any significant effect on body weight traits. a significant association was observed between the detected genotypes and litter size. whereby, litter size in doubleheterozygous does (1.21) was significantly higher than the doublehomozygous individuals (1.04), (p = 0.015). the present study is probably the first report on the association of the thrsp gene with litter size in goats. the thrsp is a protein which involves in thyroid hormone function and therefore might affect many metabolic pathways. however, a significant association of the observed genotypes with prolificacy is probably due to the role of thrsp in lipids metabolism and the association of lipids metabolism with reproduction performance.conclusions: the thrsp exon 1 is polymorphic in markhoz goats. the studied fragment did not have any significant associations with body weight traits, but it had a significant effect on litter size. based on the results of this study, the thrsp gene could be considered a candidate gene for litter size, and the detected snps at 148 and 173 bp of the studied fragment, could be used for markerassisted selection in markhoz goats. however, more studies on possible associations between thrsp polymorphism and production and reproduction traits are still needed in other goat breeds.
Keywords marker-assisted selection ,fertility ,reproduction ,single-nucleotide polymorphism ,candidate gene
 
 

Copyright 2023
Islamic World Science Citation Center
All Rights Reserved