>
Fa   |   Ar   |   En
   Listeria Monocytogenes La111 and Klebsiella Pneumoniae Kctc 2242: Shine-Dalgarno Sequences  
   
نویسنده Motalleb Gholamreza Gholamreza
منبع International Journal Of Molecular And Cellular Medicine - 2014 - دوره : 3 - شماره : 1 - صفحه:43 -50
چکیده    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with klebsiella pneumoniae are at increased risk of colorectal cancer. translation initiation codon recognition is basically mediated by shine-dalgarno (sd) and the anti-sd sequences at the small ribosomal rna (ssu rrna). in this research, shine-dalgarno sequences prediction in listeria monocytogenes la111 and klebsiella pneumoniae kctc 2242 was investigated. the whole genomic sequence of listeria monocytogenes la111 and klebsiella pneumoniae kctc 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (listeria monocytogenes la111 ncbi reference sequence: nc_020557; klebsiella pneumoniae kctc 2242 ncbi reference sequence: cp002910) in order to be analyzed with dambe software and blast. the results showed that the consensus sequence for klebsiella pneumoniae kctc 2242 was cccccccucccccucccccuccuccuccuuuuuaaaaaaggggaaaaacc and for listeria monocytogenes la111 was cccccccucccccuuucccuccuauucuuauaaaaggggg-gggguucac. the psd was higher in listeria monocytogenes la111 compared to klebsiella pneumoniae kctc 2242 (0.9090 > 0.8618). the results showed that nm in listeria monocytogenes la111 was higher than klebsiella pneumoniae kctc 2242 (4.5846 > 4.4862). accurate characterization of sd sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome.
کلیدواژه Molecular Biology ,Genomics ,Microbiology ,Shine-Dalgarno Sequences
آدرس Zabol, Department Of Biology, University Of Zabol, Zabol, Iran, ایران
پست الکترونیکی reza.motaleb@uoz.ac.ir
 
     
   
Authors
  
 
 

Copyright 2023
Islamic World Science Citation Center
All Rights Reserved