|
|
|
|
clinical characterization and mutation analysis of 13 iranian ataxia telangiectasia patients: introducing two novel mutations
|
|
|
|
|
|
|
|
نویسنده
|
badalzadeh mohsen ,soleimani bavani maryam ,alizadeh zahra ,mirmoghtadaei milad ,shakerian leila ,bahram seiamak ,molitor anne ,carapito raphael ,moradi leila ,razaghian anahita ,assari raheleh ,movahedi masoud ,shariat mansoureh ,houshmand massoud ,habibi laleh ,hamidieh amir ali ,ashrafi mahmoud reza ,fazlollahi mohammad reza ,pourpak zahra
|
|
منبع
|
iranian journal of allergy, asthma and immunology - 2025 - دوره : 24 - شماره : 2 - صفحه:187 -197
|
|
چکیده
|
Ataxia telangiectasia (a-t) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (atm) gene. the gene is on chromosome 11q22-23 and codes for the protein kinase atm, which plays an essential role in dna damage repair. in this study, we review the clinical characteristics of 13 a-t patients, 2 of whom displayed novel mutations.thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to immunology, asthma and allergy research institute, tehran, iran. after clinical confirmation, blood samples were collected from the patients and their parents. genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing.we identified 11 different mutations in the atm gene. two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. among these, 2 likely pathogenic mutations (ie, c.2639-1g>a and c.7940_7970delttccagcagaccagccaattactaaacttaa) have not been reported.our study highlights the significance of next-generation sequencing techniques in identifying novel atm mutations in a-t patients. although all reported a-t mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. this study provides new insights into the genetic underpinnings of a-t and underscores the potential clinical implications of identifying novel mutations.
|
|
کلیدواژه
|
ataxia-telangiectasia ,ataxia telangiectasia mutated proteins ,cerebellar ataxia ,iran ,mutation ,primary immunodeficiency diseases ,whole exome sequencing
|
|
آدرس
|
tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, université de strasbourg, faculté de médecine, fédération hospitalo-universitaire omicare, fédération de médecine translationnelle de strasbourg (fmts), laboratoire d’immunorhumatologie moléculaire, plateforme genomax, inserm umr_s 1109, labex transplantex, france. xe9;decine, france. xe9;d&, france. xe9;ration hospitalo-universitaire omicare, france. xe9;d&, france. xe9;ration de m&, france. xe9;decine translationnelle de strasbourg (fmts), labex transplantex, france. xe9; de strasbourg, france. x2019;immunologie biologique, france. xf4;le de biologie, france. xf4;pital civil, france. x2019;h&, france. xf4;pital, france. nouvel hôpital civil, service d’immunologie biologique, plateau technique de biologie, pôle de biologie, france, université de strasbourg, faculté de médecine, fédération hospitalo-universitaire omicare, fédération de médecine translationnelle de strasbourg (fmts), laboratoire d’immunorhumatologie moléculaire, plateforme genomax, inserm umr_s 1109, labex transplantex, france, université de strasbourg, faculté de médecine, fédération hospitalo-universitaire omicare, fédération de médecine translationnelle de strasbourg (fmts), laboratoire d’immunorhumatologie moléculaire, plateforme genomax, inserm umr_s 1109, labex transplantex, france, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, hakim children's hospital, division of allergy and clinical immunology, department of pediatrics, iran, tehran university of medical sciences, children's medical center hospital, pediatrics center of excellence, rheumatology research center, pediatric rheumatology research group, iran, tehran university of medical sciences, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, children's medical center hospital, department of immunology and allergy, iran, national institute for genetic engineering and biotechnology (nigeb), department of medical genetics, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, pediatric cell and gene therapy research center, cell & tissue research institute, iran, tehran university of medical sciences, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran, tehran university of medical sciences, immunology, asthma and allergy research institute, children's medical center hospital, pediatrics center of excellence, iran
|
|
پست الکترونیکی
|
pourpakz@tums.ac.ir
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Authors
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|