|
|
خاموشی ژن سم زدای cyp6cm1 در سفیدبالک پنبه (.gennadius) bemisia tabaci با استفاده از تکنیک rnai
|
|
|
|
|
نویسنده
|
بسیج مسلم ,طالبی خلیل ,حسینی نوه وحید ,سلامی علیرضا
|
منبع
|
گياه پزشكي - 1398 - دوره : 42 - شماره : 1 - صفحه:79 -89
|
چکیده
|
سفیدبالک (gennadius.)bemisia tabaci یکی از مهمترین آفات گیاهان زراعی و محصولات زینتی در جهان است و مشاهده شده است که قابلیت مقاوم شدن به بسیاری از گرو ههای حشرهکشها را دارد. این آفت توانایی بروز مقاومت به گروههای مختلف حشره کش از جمله نئونیکوتونوئیدها را دارا می باشد.در مطالعه ی حاضر تاثیر استفاده از تکنیک خاموشی ژن (rnai) ژن cyp6cm1 به عنوان یکی از اصلیترین ژنهای مسئول بروز مقاومت به نئونیکوتینوئیدها روی سطح نسبی بیان، اندازه مقاومت و میزان فعالیت آنزیم سیتوکروم p450 در دو جمعیت سفیدبالک پنبه مقاوم و حساس در برابر حشرهکش ایمیداکلوپرید مورد ارزیابی قرار گرفت.کلنی جمعیت های سفیدبالک پنبه روی برگهای گیاه گوجه و در اتاقک رشد پرورش یافت. rna دو رشتهای ژن cyp6cm1 با استفاده از پرایمرهای اختصاصی سنتز شد و آزمایشات زیستسنجی پس از وارد کردن dsrna به داخل بدن حشره از طرق دریافت دهانی و با محاسبه مقدار lc50 و نسبت مقاومت با استفاده از نرم افزار کامپیوتری ploplus انجام شد. اندازهگیری فعالیت مونواکسیژناز نیز با استفاده از زیر نهشت 7 اتوکسی کومارین انجام شد. آنالیز دادهها نشان داد که تغذیه دهانیdsrna به طور موثری میزان سطح بیان نسبی ژن cyp6cm1 (2 برابری)، اندازه مقاومت (5.3 برابری) و میزان فعالیت آنزیم سیتوکرومp450 (45 درصدی) را در جمعیت مقاوم تغذیهشده باcyp6cm1dsrna کاهش داد. کاهش چند برابری اندازه مقاومت بیانگر امکان استفاده عملی از تکنیکrnai در مدیریت مقاومت b. tabaci میباشد.
|
کلیدواژه
|
bemisia tabaci، ایمیداکلوپرید، مقاومت به حشرهکشها، خاموشی ژن، cyp6cm1dsrna
|
آدرس
|
دانشگاه جیرفت, دانشکده کشاورزی, گروه گیاهپزشکی, ایران, دانشگاه تهران, دانشکده کشاورزی و منابع طبیعی, گروه گیاهپزشکی, ایران, دانشگاه تهران, دانشکده کشاورزی و منابع طبیعی, گروه گیاهپزشکی, ایران, دانشگاه تهران, گروه بیوتکنولوژی, ایران
|
|
|
|
|
|
|
|
|
|
|
Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique
|
|
|
Authors
|
Basij M ,Talebi KH ,Hosseininaveh V. ,Salami S. A
|
Abstract
|
Background and Objectives The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Material and Methods Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIORAD). Doublestranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3’ TAATACGACTCACTATAGGG 5’, 3’ TAATACGACTCACTATAGGG 5’), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative crossthreshold (CT) (the PCR cycle number that crosses the signal threshold) method. Results Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3fold reduction in imidacloprid resistance of dsRNAfed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNAfed JR population adult when compared to the control (JR population without dsRNAfed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect’s reduced CYP6CM1 expression up to 2 fold when comparing to the control. Discussion Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).
|
Keywords
|
Bemisia tabaci ,CYP6CM1dsRNA
|
|
|
|
|
|
|
|
|
|
|