>
Fa   |   Ar   |   En
   بررسی اثر چند ریختی تک نوکلئوتیدیbiec2-808543 ژن lcorl براندازه بدنی اسب عرب ایرانی  
   
نویسنده ابریشمی مقدم زیبا ,میراسماعیلی محسن ,بیطرف ثانی مرتضی ,سیفتی مرتضی
منبع پژوهشهاي علوم دامي ايران - 1399 - دوره : 12 - شماره : 1 - صفحه:125 -133
چکیده    اندازه بدنی یکی از ویژگی های مهم برای ارزیابی و دسته بندی اسب ها می باشد. تجزیه و تحلیل های انجام شده با مطالعات پویش کل ژنومی نشان داده است که اسنیپ (snp) biec2808543 یکی از مهمترین چند ریختی های تک نوکلئوتیدی مرتبط با ارتفاع و اندازه بدن اسب ها است. در این مطالعه، تعیین ژنوتایپ biec2-808543 برای 141نمونه اسب اصیل عرب به وسیله pcr-rflp صورت گرفت. پس از استخراج dna، واکنش زنجیره ای پلی مراز برای تکثیر قطعه 284 جفت بازی در ژن lcorl انجام شد. محصول pcr تحت تاثیر آنزیم برشی alu1 در واکنش pcrrflp برای تعیین ژنوتایپ نمونه ها مورد بررسی قرار گرفت. نتایج نشان می دهد که الل t در اسب عرب تثبیت شده است و بر این اساس فقط یک اسب با ژنوتایپ ct یافت شد و بقیه دارای ژنوتیپ tt بودند. میزان fst برآورد شده حاکی از این است که توزیع فراوانی آللی و ژنوتیپی اسنیپ biec2-808543 در دو نوع اسب رده های کورس و زیبایی یکسان می باشد. مقایسه امتیازات داوری، نشان داد که اختلاف معنی داری بین امتیاز دست و پا و گردن در بین اسب های کورس و غیر کورس نمی باشد. در این مطالعه مشخص شد که اندازه دور قفسه سینه در اسب های کورس بیشتر از اسب های غیر کورس است و این اختلاف معنی دار بود.
کلیدواژه اسب عرب، اندازه بدنی، biec2-808543 ,lcorl
آدرس دانشگاه علم و هنر, ایران, دانشگاه علم و هنر, گروه زیست شناسی, ایران, سازمان تحقیقات، آموزش و ترویج کشاورزی, مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان یزد, بخش تحقیقات علوم دامی, ایران, دانشگاه آزاد اسلامی واحد اشکذر, مرکز تحقیقات زیست فناوری پزشکی, گروه زیست شناسی, ایران
 
   Effect of BIEC2-808543 Near LCORL on Body Size of Iranian Arab horse  
   
Authors Abrishami moghaddam ziba ,miresmaeli mohsen ,bitaraf sani morteza ,seifati morteza
Abstract    Introduction:;Body size is one of the main features for the classification of horses. Among these features, the length of the body is one of the aspects that considered essential for animal apos;s nutrition and height at withers applies for intraspecies separating. Genome Wide Association Studies have demonstrated LCORL gene code a transcription factor that those polymorphisms are associated with skeletal frame size and body length. Recently, BIEC2808543 SNP located upstream of LCORL was identified as a genetic diagnostic marker associated with withers height and also the length of Cannon bone in Thoroughbred horses. BIEC2808543 is This SNP effect on TFIID binding site in TATA box. The substitution of C to T allele causes changes affinity of TFIID to TATA box. because of this is the effect on indicating TFIID by a promotor nuclear element which is the first step in mRNA transcription and in result effects on other transcription factors of bonelike AP1, activator protein1 transcription factor complex, AP1 is activated as one complex of mRNA and subsequently transcription get higher. On the other words, skeletal bones are expanded by three chondrocytes, osteoblasts and osteoclasts cells. The difference and performances of these cells are regulated by some special factors that are effective on gene expression.;Near the LCORL gene in chromosome 3, there is a QTL which is associated with height at withers, composition of legs, length of horse apos; s rump, head and jaw of the horse. The purpose of this research was studying of genotype and allele frequency of BIEC2808543 and its relationship with body size in Iranian Arab horse.;Materials and methods:;A total of 152 (85 males and 67 females) Iranian Arab horses were used in this study. All horses were born between 1990–2015, and the mean of age was 7.3 years. All horse apos;s data were registered at WAHO and was get from Yazd Arabic Horseshoe. The time of this research was 1396 and the information was gathered from horse breeding clubs in the city of Ashkezar. The city of Ashkezar is the center of Arabic horse breeding. Measurements included withers height (cm), chest circumference (cm), and leg length. Also, each horse was judged as view of foot, head and neck and score of 020 was registered. The referee of this research was experienced experts in the Iranian horses apos; club located in Yazd. Blood samples were collected from 141 animals and in the molecular genetic laboratory of Islamic Azad University of Ashkezar stored at −20°C. Genomic DNA was extracted by Gene All kit (Company Gene All, South Korea (according to the manufacturer’s protocol. We used Thermocycler for PCR and duplication fragments. The volume of the reaction was 25 μl including 14 μl master mix, 1 μl forward, 1 μl reverse, 9μl water. Genotyping for BIEC2808543 was performed using by PCRRFLP by Alu1 (Company Sina Clone) restriction enzyme. primer designing was applied primer 3 software and the Restriction Mapper software (Online site was used) for PCR was used to distinct the used restriction enzyme. Forward primer sequence has TGGAGTCAGTTGGGTTTAATG and Reverse primer sequence has GACCGGATAGCATAGAGAGAG. Genetic association analysis for withers height, chest circumference, leg length, and judgment scores were performed using SNPassoc package (R software). compare mean between race and show horse was performed using Nonparametric mannwhitneyU. Weir Cocker ham apos;sFst was estimated by FSTAT software.; ; ;Results and discussion:;Results of Genotyping of BIEC2808543 SNP showed that one of the horses with the name of Meraj Mofidian (father name: Zelzeleh) is CT. The others were TT genotype. In this study 99/2% of horses had the TT genotype. Results represent fixation of T allele of BIEC2808543 SNP on this gene in Iranian Arab horses. There was no significant difference between scores in three aspects, hands, legs, head and neck of show and race horses. Also, Genotype frequency of BIEC280543 SNP of show and race horse was similar. Estimated FST between race and show horses was tiny amount (0.005) and show no genetic difference of LCORL gene between two groups. Though there was no significant difference of withers height, and leg length and judgment scores between race and show groups.;Conclusion:;Allele T in BIEC2808543 polymorphism in Iranian Arab horse stabilization and approves endurance of this breed. Race Iranian Arab horse have bigger Chest circumference because of racing in short distances.
Keywords
 
 

Copyright 2023
Islamic World Science Citation Center
All Rights Reserved